pacs2

Ensembl ID:
ENSDARG00000078185
ZFIN ID:
ZDB-GENE-081218-1
Description:
phosphofurin acidic cluster sorting protein 2 [Source:RefSeq peptide;Acc:NP_001116223]
Human Orthologue:
PACS2
Human Description:
phosphofurin acidic cluster sorting protein 2 [Source:HGNC Symbol;Acc:23794]
Mouse Orthologue:
Pacs2
Mouse Description:
phosphofurin acidic cluster sorting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35555 Nonsense Mutation detected in F1 DNA During 2017
sa31948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114744 Nonsense 259 878 8 24
ENSDART00000128760 Nonsense 259 888 8 25
Genomic Location (Zv9):
Chromosome 13 (position 36880945)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36353247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTCCATTAGCAGCAGAACTTTAAACAGCGGGTTGTGGCTTTGCTC[A/T]AACGCTTCAGAGTCTCAGATGAGGTGGGTGAATATTGCAATTGGTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114744 Essential Splice Site 529 878 16 24
ENSDART00000128760 Essential Splice Site 529 888 16 25
Genomic Location (Zv9):
Chromosome 13 (position 36866311)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36338613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTATAGTAACACACAGTGTGTAATATTGTGTCCTCTTCTTCTGCA[G/A]TTGTAACAGTAACTCAGTGACTCCTTCTCCTGTGCGTGTCGGAGTGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link