sc:d0202

Ensembl ID:
ENSDARG00000078180
ZFIN ID:
ZDB-GENE-080226-9
Description:
hypothetical protein LOC569842 [Source:RefSeq peptide;Acc:NP_001091722]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20123 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115076 Splice Site, Nonsense 218 292 4 4
Genomic Location (Zv9):
Chromosome 3 (position 46464788)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48474341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATGTCTTTGCTGTAGTGCTGAAAATTTGTTCCTATGTGCTCCTCAGA[T/G]AAACCAAAACACTCCAGGTCCACAGAGAAGATCAGTCAGAGTGATGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link