fndc3ba

Ensembl ID:
ENSDARG00000078179
ZFIN ID:
ZDB-GENE-070510-1
Description:
fibronectin type III domain-containing protein 3B [Source:RefSeq peptide;Acc:NP_001153304]
Human Orthologue:
FNDC3B
Human Description:
fibronectin type III domain containing 3B [Source:HGNC Symbol;Acc:24670]
Mouse Orthologue:
Fndc3b
Mouse Description:
fibronectin type III domain containing 3B Gene [Source:MGI Symbol;Acc:MGI:1919257]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19762 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18483 Nonsense Available for shipment Available now
sa11399 Essential Splice Site Available for shipment Available now
sa16307 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089108 Essential Splice Site 168 1202 4 25

The following transcripts of ENSDARG00000078179 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 25603403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCACACCAGTACTACCAGCACCACCTCCCGCCCATGTACAATGAAG[G/A]TAAGAGTGTGTGTGTTTGTGTGTGTGATCAAGACTTTTATTAAGCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089108 Nonsense 313 1202 7 25

The following transcripts of ENSDARG00000078179 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 25628411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGAACAGAGAGAGGCAYAGTAACGGACACCCRTTTACCWGCAGCTA[T/A]GAGGTCGCTCTCTCAGACAAGGGTCGGAACGGCCAGTACCGCATCATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089108 Essential Splice Site 331 1202 7 25

The following transcripts of ENSDARG00000078179 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 25628466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTCTCTCAGACAAGGGTCGGAACGGCCAGTACCGCATCATCTATAGG[T/C]AAGACACAGAGGAGCTGTTTTGACCATGCAAAAATCCTTGAAGTCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089108 Nonsense 705 1202 18 25

The following transcripts of ENSDARG00000078179 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 25651321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGACTGTCCTTCCKCTGAAGGGGCATGCGAGGTGAGCGAGTACAGTT[T/A]GGAAATGAGGGAGGGAGTGATGGAGCCAGCTGAGGTCTATCACGGTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tbh99rm6