PTGFRN (1 of 2)

Ensembl ID:
ENSDARG00000078172
Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Human Orthologue:
PTGFRN
Human Description:
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologue:
Ptgfrn
Mouse Description:
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34536 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112635 Nonsense 78 466 1 6
Genomic Location (Zv9):
Chromosome 9 (position 494812)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 511282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGTGCTCTGACCGCAGGAGCGCAGTATCAGCAGAGATTGGATCGC[G/T]GAGACATCGCTCTGACCAGAACACCAGACAACACCTTCATGCTGCGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link