ENSDARG00000078168

Ensembl ID:
ENSDARG00000078168

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43355 Nonsense Mutation detected in F1 DNA During 2016
sa23608 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109480 Nonsense 237 538 1 2
Genomic Location:
Chromosome 19 (position 50089526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAATGTCCACCTCTTCCATCCCTCAGGGTTCCTCCTCTTCTGTTCCC[C/T]AAATTTCCACCTCTTCCATCCCTCAGAGTTCCTCCTCTTCTGTTCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109480 Nonsense 506 538 2 2
Genomic Location:
Chromosome 19 (position 50088700)
KASP Assay ID:
2261-3777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAATATACCTTTATCTCCATCAGCTCGAGCATACACTATCATTAAGT[C/A]AACCAAAGTAGTCACCTTTGACCTTTCAGGTCCCTCAGACCACATCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link