si:ch211-163l21.4

Ensembl ID:
ENSDARG00000078155
ZFIN ID:
ZDB-GENE-081105-161
Description:
Novel protein similar to vertebrate FERM domain containing 4A (FRMD4A) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
C1orf106
Human Description:
chromosome 1 open reading frame 106 [Source:HGNC Symbol;Acc:25599]
Mouse Orthologue:
5730559C18Rik
Mouse Description:
RIKEN cDNA 5730559C18 gene Gene [Source:MGI Symbol;Acc:MGI:1921579]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34395 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114800 Essential Splice Site 193 583 4 10
ENSDART00000132659   None 310 None 3
ENSDART00000141871 Essential Splice Site 184 201 4 5
Genomic Location (Zv9):
Chromosome 8 (position 24613573)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23739391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCACGGCTGTGTTTCTCCTCAAACCTGCTATTCGTCCAGGCAGAGAGG[T/G]CAGACACAGATGACATTACATTTGAAGTATTAGCAAAGTGACTGTTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link