si:ch211-264f5.8

Ensembl ID:
ENSDARG00000078151
ZFIN ID:
ZDB-GENE-081104-209
Human Orthologue:
GRIK5
Human Description:
glutamate receptor, ionotropic, kainate 5 [Source:HGNC Symbol;Acc:4583]
Mouse Orthologue:
Grik5
Mouse Description:
glutamate receptor, ionotropic, kainate 5 (gamma 2) Gene [Source:MGI Symbol;Acc:MGI:95818]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43211 Nonsense Mutation detected in F1 DNA During 2017
sa23431 Nonsense Available for shipment Available now
sa23430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 421 979 10 18
ENSDART00000134340   None 413 None 5
Genomic Location (Zv9):
Chromosome 19 (position 6446085)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5904850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGAACTACCAGGACTTTCAGGGTAGCGATCAGTACGAGGGCTTCTG[T/A]GTGGATATGCTGCGAGAGCTGGCAGACATACTCAAGTTTTCCTTCCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 544 979 13 18
ENSDART00000134340   None 413 None 5
Genomic Location (Zv9):
Chromosome 19 (position 6435346)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5894111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTATTTGTTTGTGTGTTTGGCGTCTGCTATCAGGCTGAGTCCTTA[T/G]GAGTGGTACAACCCATTCCCGTGTTGGCGGGAGCGCAGGGACCTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114472 Nonsense 803 979 17 18
ENSDART00000134340 Nonsense 205 413 4 5
Genomic Location (Zv9):
Chromosome 19 (position 6408415)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5867270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTGGGCTCATAATCGCTGTTTTTGTAGCCATTATGGAGTTTGTGTG[G/A]TCCACGCGCCGGTCGGCGGAGACAGATGAGGTACGCCCTCACCCCTGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link