grin2ca

Ensembl ID:
ENSDARG00000078149
ZFIN ID:
ZDB-GENE-070822-3
Human Orthologue:
GRIN2C
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2C [Source:HGNC Symbol;Acc:4587]
Mouse Orthologue:
Grin2c
Mouse Description:
glutamate receptor, ionotropic, NMDA2C (epsilon 3) Gene [Source:MGI Symbol;Acc:MGI:95822]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14471 Nonsense Available for shipment Available now
sa19980 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26037 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa14471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110554 Nonsense 245 1400 2 12
ENSDART00000145215 Nonsense 245 1400 3 13
Genomic Location:
Chromosome 3 (position 18890892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGACGCGCAAGTGCTGCTGGTTTACTGTTCTCACGATGAGGCCCAGTA[T/A]CTTTTCTCCATGGCCAGGGAAGTGGGTCTGGTTGGTCCAGGCTACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110554 Essential Splice Site 342 1400 3 12
ENSDART00000145215 Essential Splice Site 342 1400 4 13
Genomic Location:
Chromosome 3 (position 18877248)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGATATTCTACAAATATCATTTAGAAAACATCTGTCTGATTTTTTGC[A/T]GGCATATGCTGAATGTGTCGTGGGAGAACACTGATTTCTCCTTCAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110554 Nonsense 473 1400 5 12
ENSDART00000145215 Nonsense 473 1400 6 13
Genomic Location:
Chromosome 3 (position 18845243)
KASP Assay ID:
2259-3274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCCTTACACCAAACTCTGCTGCAAAGGCTTCTGCATAGACATCCTG[A/T]AAAAGCTCTCTCGCAACATCAAGTTCTCCTATGACCTCTACCTGGTCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0kes14qs