grin2ca

Ensembl ID:
ENSDARG00000078149
ZFIN ID:
ZDB-GENE-070822-3
Human Orthologue:
GRIN2C
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2C [Source:HGNC Symbol;Acc:4587]
Mouse Orthologue:
Grin2c
Mouse Description:
glutamate receptor, ionotropic, NMDA2C (epsilon 3) Gene [Source:MGI Symbol;Acc:MGI:95822]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14471 Nonsense Available for shipment Available now
sa19980 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110554 Nonsense 245 1400 2 12
ENSDART00000145215 Nonsense 245 1400 3 13
Genomic Location:
Chromosome 3 (position 18890892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGACGCGCAAGTGCTGCTGGTTTACTGTTCTCACGATGAGGCCCAGTA[T/A]CTTTTCTCCATGGCCAGGGAAGTGGGTCTGGTTGGTCCAGGCTACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110554 Essential Splice Site 342 1400 3 12
ENSDART00000145215 Essential Splice Site 342 1400 4 13
Genomic Location:
Chromosome 3 (position 18877248)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGATATTCTACAAATATCATTTAGAAAACATCTGTCTGATTTTTTGC[A/T]GGCATATGCTGAATGTGTCGTGGGAGAACACTGATTTCTCCTTCAACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0kes14qs