il10

Ensembl ID:
ENSDARG00000078147
ZFIN ID:
ZDB-GENE-051111-1
Description:
interleukin-10 [Source:RefSeq peptide;Acc:NP_001018621]
Human Orthologue:
IL10
Human Description:
interleukin 10 [Source:HGNC Symbol;Acc:5962]
Mouse Orthologue:
Il10
Mouse Description:
interleukin 10 Gene [Source:MGI Symbol;Acc:MGI:96537]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21894 Nonsense Mutation detected in F1 DNA During 2014
sa1423 Nonsense Available for shipment Available now
e46 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa21894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110673 Nonsense 21 180 1 5
Genomic Location:
Chromosome 11 (position 21971299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTCATCCTTTCTGCTCTGCTCACGCTTCTTCTTTGCGACTGTGCT[C/T]AGAGCAGGAGAGTCGAATGCAAAACTGACTGTTGCTCATTTGTGGAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110673 Nonsense 26 180 1 5
Genomic Location:
Chromosome 11 (position 21971314)
KASP Assay ID:
554-1344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGCTCACGCTTCTTCTTTGCGACTGTGCTCAGAGCAGGAGAGTC[G/T]AATGCAAAACTGACTGTTGCTCATTTGTGGAGGGCTTTCCTTTAAGACTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
e46
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110673 Nonsense 28 180 1 5
Genomic Location:
Chromosome 11 (position 21971320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATTTTCTCTGGAGTCATCCTTTCTGCTCTGCTCACGCTTCTTCTTTGCGACTGTGCTCAGAGCAGGAGAGTCGAATGC[A/T]AAACTGACTGTTGCTCATTTGTGGAGGGCTTTCCTTTAAGACTGAGGGAGCTCCGTTCTGCATACAAAGAAATTCAGAAGTTTTATGTAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bd7ulzwt