LOC562570

Ensembl ID:
ENSDARG00000078141
Mouse Orthologue:
Elfn1
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 1 Gene [Source:MGI Symbol;Acc:MGI:244247

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3449 Nonsense Mutation detected in F1 DNA During 2014
sa8142 Nonsense Mutation detected in F1 DNA During 2014
sa6913 Nonsense Mutation detected in F1 DNA During 2014
sa14448 Nonsense Available for shipment Available now
sa13873 Nonsense Available for shipment Available now
sa14082 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 223 784 1 1
Genomic Location:
Chromosome 3 (position 43997207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACAAGTGAGCGGATGGTATGTGACTCTCCTGCAGGGGTCTCAGGCTA[C/A]AGTCTTCTAAGCCAGAATCCGRCCAATCCCACATACCGGAATGCTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 297 784 1 1
Genomic Location:
Chromosome 3 (position 43997427)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGCCGGAGGAAATCAGCATAAGTCCCRCGTTCCTAGATTTAGATGTG[A/T]AACCAATCATGAAACTYWAACAAGTGTCTCACACGAACGCAGTAATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 303 784 1 1
Genomic Location:
Chromosome 3 (position 43997445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATAAGTCCCRCGTTCCTAGATTTAGATGTGWAACCAATCATGAAACTY[A/T]AACAAGTGTCTCACACGAACGCAGTAATCACTGTTCAGATCCCTTACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 418 784 1 1
Genomic Location:
Chromosome 3 (position 43997792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTAGGATGTCTTTTCAGTATKGTAATCRTTTTAGGCATTGTGTATTA[T/G]TGTTTGCGGAAAAAGAGGCAACAAGATGAAAAGCACAAAAAGGCAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 624 784 1 1
ENSDART00000111535 Nonsense 624 784 1 1
Genomic Location:
Chromosome 3 (position 43998410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGTCCCAGTACAGCTACTGGAGRTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGARTCAAAGTACATAGAGAAGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111535 Nonsense 624 784 1 1
ENSDART00000111535 Nonsense 624 784 1 1
Genomic Location:
Chromosome 3 (position 43998410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGTCCCAGTACAGCTACTGGAGRTTCAATACGAAGCCCGAGGCCTTA[T/A]CGTTCAGAAGGGTCATACAAGTCAGARTCAAAGTACATAGAGAAGACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bu0ta1gy