MRC2

Ensembl ID:
ENSDARG00000078135
Description:
mannose receptor, C type 2 [Source:HGNC Symbol;Acc:16875]
Human Orthologue:
MRC2
Human Description:
mannose receptor, C type 2 [Source:HGNC Symbol;Acc:16875]
Mouse Orthologue:
Mrc2
Mouse Description:
mannose receptor, C type 2 Gene [Source:MGI Symbol;Acc:MGI:107818]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19984 Nonsense Mutation detected in F1 DNA During 2014
sa12797 Nonsense Available for shipment Available now
sa10955 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109409 Nonsense 302 1391 5 26
Genomic Location:
Chromosome 3 (position 19658784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCGTGCTTGTGTGTAGGTTTGCTCATCGGATACAGTGCCACCCTGTG[G/A]ATGGGTTTGAATGATCTGGATCTGAATGGTGGCTGGCAGTGGGCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109409 Nonsense 797 1391 15 26
Genomic Location:
Chromosome 3 (position 19681072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGCGGAGCTGCTAACATGGCCGACACYAACTGGCTGGTGTCCCACTG[T/A]GAATCTGAGCTAGACTGGATCTGCAAAATACCCAAAGGGAAAGTAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109409 Nonsense 982 1391 19 26
Genomic Location:
Chromosome 3 (position 19686762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWAWCAACAAYCCTTGAGTTCTGTTTTCCCCTTCATAACAACAGTGCTAT[A/T]AGGTGTTTGGAGAGGAGCTGTCGAGTCGCAGCACTTGGGACRCTGCTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/setwaw0b