ENSDARG00000078133

Ensembl ID:
ENSDARG00000078133
Human Orthologues:
FBXL19, KDM2A, KDM2B
Human Descriptions:
F-box and leucine-rich repeat protein 19 [Source:HGNC Symbol;Acc:25300]
lysine (K)-specific demethylase 2A [Source:HGNC Symbol;Acc:13606]
lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610]
Mouse Orthologues:
Fbxl19, Kdm2a, Kdm2b
Mouse Descriptions:
F-box and leucine-rich repeat protein 19 Gene [Source:MGI Symbol;Acc:MGI:3039600]
lysine (K)-specific demethylase 2A Gene [Source:MGI Symbol;Acc:MGI:1354736]
lysine (K)-specific demethylase 2B Gene [Source:MGI Symbol;Acc:MGI:1354737]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1479 Nonsense Available for shipment Available now
sa2775 Nonsense Mutation detected in F1 DNA During 2014
sa19081 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 268 1275 8 28
Genomic Location:
Chromosome 14 (position 22763031)
KASP Assay ID:
554-1404.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCGACATCTTTCTTGGGGATAAAGCCTCTATGTGCCAACGGATTGAAT[T/A]GAAACAAGGCTACACCTTTATGATCCCCTCAGGTATGCACATWCTGCAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 1101 1275 25 28
ENSDART00000111839 Nonsense 1101 1275 25 28
Genomic Location:
Chromosome 14 (position 22775605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGCTTTCTCACAGGCCTTAAAGATCTGGTGCTATCAGGGTGTAACTG[G/A]TCGTCAGTTTCAGCATTGAGCTCTCCAAGCTGCCCTTTACTGCGCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111839 Nonsense 1101 1275 25 28
ENSDART00000111839 Nonsense 1101 1275 25 28
Genomic Location:
Chromosome 14 (position 22775605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTTTCTCACAGGCCTTAAAGATCTGGTGCTATCAGGGTGTAACTG[G/A]TCGTCAGTTTCAGCATTGAGCTCTCCAAGCTGCCCTTTACTGCGCTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wl1e0wjs