LOC100004729

Ensembl ID:
ENSDARG00000078132
Human Orthologue:
TEX2
Human Description:
testis expressed 2 [Source:HGNC Symbol;Acc:30884]
Mouse Orthologue:
Tex2
Mouse Description:
testis expressed gene 2 Gene [Source:MGI Symbol;Acc:MGI:102465]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14815 Essential Splice Site Available for shipment Available now
sa9607 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 584 997 3 11
Genomic Location:
Chromosome 12 (position 19535551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTGTCCATCCAGAATGAAGAGGACCAYTATGAATCWACAWTTGGTG[G/A]YAAAGTTGCAATCAGTTTTGACTCAAAGTCAAAGACTTRTAAGGGTCCKT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 585 997 3 11
Genomic Location:
Chromosome 12 (position 19535550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTCCATCCAGAATGAAGAGGACCAYTATGAATCTACATTTGGTGG[T/C]AAAGTTGCAATCAGTTTTGACTCAAAGTCAAAGACTTATAAGGGTCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/khm0eyby