LOC100002532

Ensembl ID:
ENSDARG00000078130
Human Orthologue:
ERICH1
Human Description:
glutamate-rich 1 [Source:HGNC Symbol;Acc:27234]
Mouse Orthologue:
Erich1
Mouse Description:
glutamate-rich 1 Gene [Source:MGI Symbol;Acc:MGI:3588201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23083 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115335 Nonsense 107 312 4 7
Genomic Location:
Chromosome 17 (position 24761195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGCCCTTTTTTTATTATTTGGATCTTTCAGATGCTGGTGATCATGAGT[T/G]ACATAAGAAGAGGAAAAGGAGGAGAAAGAAAAAAGTGTTTCCCAGTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zehri4ku