LOC555331

Ensembl ID:
ENSDARG00000078127
Human Orthologue:
NEURL4
Human Description:
neuralized homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:34410]
Mouse Orthologue:
Neurl4
Mouse Description:
neuralized homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921092]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22093 Essential Splice Site Available for shipment Available now
sa22092 Nonsense Available for shipment Available now
sa22091 Essential Splice Site Available for shipment Available now
sa22090 Nonsense Available for shipment Available now
sa6252 Nonsense Mutation detected in F1 DNA During 2016
sa31873 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Essential Splice Site 247 1588 3 29
Genomic Location (Zv9):
Chromosome 12 (position 23843538)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22366700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCACAGTCGGCCGGACAAATTTCCAAATAACTTTGAGCCTGATAGTG[G/A]TATGTTACATTAAAATGGATTCTTATTTATAAATCATCAATAATCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Nonsense 439 1588 6 29
Genomic Location (Zv9):
Chromosome 12 (position 23839761)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22362923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTTTTTGTCTTTAAGGCACAATAATGATGAGTGGCTGTGGGATTT[T/A]AACCAATGGGAAAGGGACTCGTCGGGAATACTGCGAATTCAGCCTGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Essential Splice Site 483 1588 7 29
Genomic Location (Zv9):
Chromosome 12 (position 23839531)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22362693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAGCCAGTGGAGCACTGCACTTCTACATTAATGGCATTGATCAAGG[T/C]GAGACTGGTTTAGACATATAGCCTTGAGCGGGTATTCCCAAACTTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Nonsense 1410 1588 26 29
Genomic Location (Zv9):
Chromosome 12 (position 23812576)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22335738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACTGTGAGTCCTGTCATAAATTAAGGGGTGATGAGGCCTATTACAAG[C/T]GAGGAGAGCCCCCCAGAGACTATGCTCTACCGTTCGGCTGGTGCCGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Nonsense 1447 1588 27 29
Genomic Location (Zv9):
Chromosome 12 (position 23812357)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22335519
KASP Assay ID:
554-5085.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCCACTGTGAAGTCTCCAATGCCTTCAAGAAGTGGCACATTGCGTA[T/A]CACGGCACAAGTGTCGGTTCTCTTAGACGCACCCTGGACCACAACCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109707 Nonsense 1546 1588 29 29
Genomic Location (Zv9):
Chromosome 12 (position 23807535)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22330697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACCAGGCTCAGGTGGGCTTCCAGGTGTGTGTCCGGCCAGGCTCCTA[T/A]AAAGTAGGTCCGTCGTCTTTAGGAATCAGCGAGCCGCTAGACCCGCGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link