LOC100334261

Ensembl ID:
ENSDARG00000078123
Human Orthologue:
SLITRK3
Human Description:
SLIT and NTRK-like family, member 3 [Source:HGNC Symbol;Acc:23501]
Mouse Orthologue:
Slitrk3
Mouse Description:
SLIT and NTRK-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2679447]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17255 Nonsense Available for shipment Available now
sa23205 Nonsense Mutation detected in F1 DNA During 2014
sa10986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 16 858 1 2
Genomic Location:
Chromosome 18 (position 2756601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACTCGGCGGAAGGATGCTGTGGTTTACCCTGCTAAGCACAATAGCTT[T/A]AGGATGGACTACGCCGATCCCTCTGTTGGACGAGTCGGAAGAAAKAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 445 858 2 2
Genomic Location:
Chromosome 18 (position 2757926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGAACCTACCTAATCTAAAAAGTTTATACTTGAATGGCAATGACATC[G/T]AAAGACTCACTCCAGGCATGTTCCGCGGGCTTCAGGCACTAAGTTACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 809 858 2 2
Genomic Location:
Chromosome 18 (position 2759018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTCCCAAATTAAAGGACATGCACGTTGCACACGCACATCCCCCAGGAATG[C/T]AATACCCCGATTTACAGCAAGACGCCAGATTAAAAGAAACATTACTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8o3ri9lu