LOC100334261

Ensembl ID:
ENSDARG00000078123
Human Orthologue:
SLITRK3
Human Description:
SLIT and NTRK-like family, member 3 [Source:HGNC Symbol;Acc:23501]
Mouse Orthologue:
Slitrk3
Mouse Description:
SLIT and NTRK-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2679447]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17255 Nonsense Available for shipment Available now
sa23205 Nonsense Available for shipment Available now
sa36556 Nonsense Mutation detected in F1 DNA During 2016
sa10986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 16 858 1 2
Genomic Location (Zv9):
Chromosome 18 (position 2756601)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2146268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACTCGGCGGAAGGATGCTGTGGTTTACCCTGCTAAGCACAATAGCTT[T/A]AGGATGGACTACGCCGATCCCTCTGTTGGACGAGTCGGAAGAAAKAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 445 858 2 2
Genomic Location (Zv9):
Chromosome 18 (position 2757926)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2147593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGAACCTACCTAATCTAAAAAGTTTATACTTGAATGGCAATGACATC[G/T]AAAGACTCACTCCAGGCATGTTCCGCGGGCTTCAGGCACTAAGTTACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 794 858 2 2
Genomic Location (Zv9):
Chromosome 18 (position 2758973)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2148640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGACCCCTACGGTTGGTTTTGTAGACTGCCTCTACGGCACGGTTCCC[A/T]AATTAAAGGACATGCACGTTGCACACGCACATCCCCCAGGAATGCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114010 Nonsense 809 858 2 2
Genomic Location (Zv9):
Chromosome 18 (position 2759018)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2148685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTCCCAAATTAAAGGACATGCACGTTGCACACGCACATCCCCCAGGAATG[C/T]AATACCCCGATTTACAGCAAGACGCCAGATTAAAAGAAACATTACTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link