SDK2 (2 of 2)

Ensembl ID:
ENSDARG00000078116
Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Human Orthologue:
SDK2
Human Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Mouse Orthologue:
Sdk2
Mouse Description:
sidekick homolog 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2443847]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20127 Nonsense Available for shipment Available now
sa14658 Nonsense Available for shipment Available now
sa9046 Nonsense Mutation detected in F1 DNA During 2017
sa25259 Nonsense Mutation detected in F1 DNA During 2017
sa15654 Nonsense Available for shipment Available now
sa2127 Essential Splice Site F2 line generated During 2017
sa14263 Essential Splice Site Available for shipment Available now
sa26140 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9315 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 6 2106 1 44
Genomic Location (Zv9):
Chromosome 3 (position 47784154)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50099131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTAGTTGATGGGATTGTCATTTTCTTTCACCAGGTATGTAATTCCAT[C/A]GCTGGACCGCTCTCATGCAGGCTTCTACAGATGTATTGTCAGGAACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 841 2106 18 44
Genomic Location (Zv9):
Chromosome 3 (position 47848469)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50034816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTCCTGTAGGTCACCTGAGCTTTACAGAAATCCTGGACACATCTCTC[A/T]AAGTGAGCTGGAAAGACCCGCCTGAGAAGAATGGCATCCTCAYAGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 874 2106 19 44
Genomic Location (Zv9):
Chromosome 3 (position 47848650)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50034635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCATTTCTTGGGAGGAATTCAACCGGACAAACACTCGTGTCACGCATTA[C/A]CTGCCGAACATGACGCAGGAATACCGGGTCACCGGTCTGACMGCACTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1016 2106 22 44
Genomic Location (Zv9):
Chromosome 3 (position 47853196)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50030089
KASP Assay ID:
554-7813.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAGACAAGTAAATATAGTGGGCACAAGCCCACCCAGTCAACCATCC[A/T]GAAAGATCCAGACCCTACAGGCTCCTCCAGACATCGCCCCAGCCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1100 2106 23 44
Genomic Location (Zv9):
Chromosome 3 (position 47856288)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50026997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACAGGAGAGAGAGTTTRCCATCGAGGACTTGGAAGAGTGGACAGAATA[T/G]GAAGTTAAARTCCAGGCGTTCAACGGYATCGGACCAGGACCATGGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2127
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1229 2106 26 44
Genomic Location (Zv9):
Chromosome 3 (position 47857638)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50025647
KASP Assay ID:
554-3357.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGAGTCCTACCTRTAGTACATTTACTTTTTTATTATTATTATTTAAAC[A/T]GTACCTGGGCCTCCAGTTGGGATCCTTTTCCCTGAAGTCAGGACCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1429 2106 29 44
Genomic Location (Zv9):
Chromosome 3 (position 47859911)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50023374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGCGAGTACAGTGAGGAGAGTGAGGCAATCACCACTCTACAGGAYGG[T/C]AGGTTCAATTGTGRAATGCTATTGGGGAACAAGTTCCTGAGGCCTGAGGK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Essential Splice Site 1589 2106 34 44
Genomic Location (Zv9):
Chromosome 3 (position 47867018)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50016267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCCTCCTCCAGTGGAGGCCCAGAATGGGGATATTCAAGGCTATAAG[G/A]TACAACAAACCGGTTCTGTCCTTCAAATGATTCTGTTGTGACTCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113318 Nonsense 1737 2106 37 44
Genomic Location (Zv9):
Chromosome 3 (position 47879325)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50003960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGACGGCGTAACCTACAACTTCCGCATCCGCGCTAAAACTCTTACCTA[T/A]GGAYCAGAGATTGAGGCCAACATCACCACTGGCCCTGGAGAGGGTACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link