si:ch73-237c6.1

Ensembl ID:
ENSDARG00000078114
ZFIN ID:
ZDB-GENE-081105-55
Description:
complement factor properdin [Source:RefSeq peptide;Acc:NP_001107051]
Human Orthologue:
CFP
Human Description:
complement factor properdin [Source:HGNC Symbol;Acc:8864]
Mouse Orthologue:
Cfp
Mouse Description:
complement factor properdin Gene [Source:MGI Symbol;Acc:MGI:97545]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38688 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099791 Nonsense 54 437 2 10
ENSDART00000139897 Nonsense 54 437 4 12
Genomic Location (Zv9):
Chromosome 8 (position 24554114)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23679932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGTTGGGTGAGACTGAAAAAGATTTTTGTTGCATAAACCCCAGCTA[T/G]GGCTTCGCTGAAGCAGACGGAGTTTGTAGGAGCTGTGGGTAAGTTTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link