KIAA0415

Ensembl ID:
ENSDARG00000078111
Description:
KIAA0415 [Source:HGNC Symbol;Acc:22197]
Human Orthologue:
KIAA0415
Human Description:
KIAA0415 [Source:HGNC Symbol;Acc:22197]
Mouse Orthologue:
C330006K01Rik
Mouse Description:
RIKEN cDNA C330006K01 gene Gene [Source:MGI Symbol;Acc:MGI:1924908]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14855 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108618 Nonsense 57 814 2 17
Genomic Location (Zv9):
Chromosome 3 (position 40891427)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40754787
KASP Assay ID:
1641-0477.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGGATTCTCTTCAGAGGCTCCATTTGAYTGTTTCTGCTACTAAATA[T/A]GCCAGAGAGTAAGTCTTGTTYAYTTTCAATACATTTGAACTGACATGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link