ocrl

Ensembl ID:
ENSDARG00000078106
ZFIN ID:
ZDB-GENE-061110-61
Description:
inositol polyphosphate 5-phosphatase OCRL-1 [Source:RefSeq peptide;Acc:NP_001071232]
Human Orthologue:
OCRL
Human Description:
oculocerebrorenal syndrome of Lowe [Source:HGNC Symbol;Acc:8108]
Mouse Orthologue:
Ocrl
Mouse Description:
oculocerebrorenal syndrome of Lowe Gene [Source:MGI Symbol;Acc:MGI:109589]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24963 Nonsense Mutation detected in F1 DNA During 2014
sa11582 Essential Splice Site Available for shipment Available now
sa17235 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112268 Nonsense 123 952 5 23
ENSDART00000131655 Nonsense 124 953 5 23
Genomic Location:
Chromosome 14 (position 34933790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACGGGCAAACGCAGTCTTTTCTTGAGCATGTGACGAAGGCCAAACAG[C/T]AAGGTGATACACCTTATTTTCCCTGCACAGGATGCAGCCGCAAACATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112268 Essential Splice Site 631 952 17 23
ENSDART00000131655 Essential Splice Site 632 953 17 23
Genomic Location:
Chromosome 14 (position 34947418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAATTTCTAGCCTAATAYTTATGTTYTRCCTGTTCTYTTATCACTA[G/T]TTCACCTTTGAGAATKTGAAGTTCCGTCAGCTGCAGCGTCAGAGTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112268 Nonsense 670 952 17 23
ENSDART00000131655 Nonsense 671 953 17 23
Genomic Location:
Chromosome 14 (position 34947538)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCTTGCACCTTCGCCTTTATTCCCAAACTCAATGACTCCCAATACTG[T/A]AAGCCCTGGTTACGTGCTGAGCCCTGTGAAGGGGTACTAGATCCTAGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d6njakuk