si:ch211-150i13.1

Ensembl ID:
ENSDARG00000078102
ZFIN ID:
ZDB-GENE-090313-44
Description:
Novel protein similar to vertebrate pleckstrin and Sec7 domain containing (PSD) [Source:UniProtKB/Tr
Human Orthologue:
PSD
Human Description:
pleckstrin and Sec7 domain containing [Source:HGNC Symbol;Acc:9507]
Mouse Orthologue:
Psd
Mouse Description:
pleckstrin and Sec7 domain containing Gene [Source:MGI Symbol;Acc:MGI:1920978]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8714 Nonsense Mutation detected in F1 DNA During 2017
sa35474 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112900 Nonsense 109 1603 1 16
ENSDART00000140151   None 504 None 12
Genomic Location (Zv9):
Chromosome 13 (position 22921204)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22650542
KASP Assay ID:
2260-6340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACTCTGACCAATCGACAACCCAGCACCAAAAAAACCTACCTTATGAT[G/T]AGATAAGYCARTTACTCTCTGTCCTCCAAACAGGAACCACTGGAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112900 Essential Splice Site 1093 1603 5 16
ENSDART00000140151   None 504 None 12
Genomic Location (Zv9):
Chromosome 13 (position 22906679)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22636017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCATTTACTAGCATTCAGATTATTCTTATTTTTAATTTTTTTGTTTCC[A/T]GAGAGAGGCCATCACGACCAGTGTCTGAGTCTGATCCAGAGGTAGCTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link