si:ch73-387e10.3

Ensembl ID:
ENSDARG00000078095
ZFIN ID:
ZDB-GENE-091204-292
Human Orthologue:
KIAA1737
Human Description:
KIAA1737 [Source:HGNC Symbol;Acc:20365]
Mouse Orthologue:
2310044G17Rik
Mouse Description:
RIKEN cDNA 2310044G17 gene Gene [Source:MGI Symbol;Acc:MGI:1919185]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43554 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113792 Nonsense 257 316 3 3
ENSDART00000144633   None 113 None 2
Genomic Location (Zv9):
Chromosome 20 (position 54678956)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54550870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGGAAAGTAAAACCAAACGTTTCTGCAACACCTACAACATCCTGAGT[A/T]AATCCGGTCTGCTGGACATCACGCTGCGCACCAAAGAGCTAATCCGGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link