lmf2a

Ensembl ID:
ENSDARG00000078094
ZFIN ID:
ZDB-GENE-080723-47
Description:
lipase maturation factor 2 [Source:RefSeq peptide;Acc:NP_001122236]
Human Orthologue:
LMF2
Human Description:
lipase maturation factor 2 [Source:HGNC Symbol;Acc:25096]
Mouse Orthologue:
Lmf2
Mouse Description:
lipase maturation factor 2 Gene [Source:MGI Symbol;Acc:MGI:2146015]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23216 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111343 Nonsense 657 737 14 14
ENSDART00000128890 Nonsense 657 737 14 15
Genomic Location (Zv9):
Chromosome 18 (position 5813541)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6768642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACCTTGTGTCTCCTCAGCTCTCTGAGACCGCACAGAAAACATCACCAA[C/T]AACACCAATCACTCCTGAACCAACACACAGAGAAAGAGCCCACAGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link