LOC560139

Ensembl ID:
ENSDARG00000078092
Human Orthologue:
LIMD2
Human Description:
LIM domain containing 2 [Source:HGNC Symbol;Acc:28142]
Mouse Orthologue:
Limd2
Mouse Description:
LIM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915053]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14342 Nonsense Available for shipment Available now
sa20046 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111828 Nonsense 26 126 2 4
Genomic Location:
Chromosome 3 (position 31990783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTGTTTCCAGGACAACAGGAACACGTCGGATGAMAAGCCTGTTCAA[C/T]GATCTAAGGTTTGTTGCTTTTTATTTMGTATTWCCTATACCTTTACAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111828 Nonsense 78 126 4 4
Genomic Location:
Chromosome 3 (position 31988281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATACTTTCTAAAAATGTTTTGTTTTGTTGTGTGCAGTCTGGGCTCTTA[C/A]GCAGCTCTGCAGGGCGAGTTTTACTGCAAACCACACTTCCAGCAGCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/48t76gx9