PTPRU_DANRE

Ensembl ID:
ENSDARG00000078090
Description:
Receptor-type tyrosine-protein phosphatase U [Source:UniProtKB/Swiss-Prot;Acc:B3DK56]
Human Orthologue:
PTPRU
Human Description:
protein tyrosine phosphatase, receptor type, U [Source:HGNC Symbol;Acc:9683]
Mouse Orthologue:
Ptpru
Mouse Description:
protein tyrosine phosphatase, receptor type, U Gene [Source:MGI Symbol;Acc:MGI:1321151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22899 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078970 Essential Splice Site 806 1074 None 24
ENSDART00000092471 Essential Splice Site 802 1067 None 23
ENSDART00000092505 Essential Splice Site 792 1057 None 22
Genomic Location (Zv9):
Chromosome 16 (position 37651007)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34990423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGGTGGATTCTCAGAGCAACTCTTCACAGCTGCGAGAGGAGTTCCAGG[T/C]TTTTGGCTTTACTTGCCTTAATACTTTGTGTAGTATATATTTAATATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link