LOC556807

Ensembl ID:
ENSDARG00000078088
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15748 Nonsense Available for shipment Available now
sa15416 Nonsense Available for shipment Available now
sa21053 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 95 2532 2 35
Genomic Location:
Chromosome 7 (position 49150793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAACGGRCACGTGCGGACRACAGGCCTCCCCCTTCAGAGAGACAGA[G/T]AGTATCTYCTAACAGTARTGGCTGCAGACCGGCAGGGCAGCCGCAGWCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 939 2532 17 35
Genomic Location:
Chromosome 7 (position 49026457)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCCTGAGGTGGGGACCAYCTTCAWCGCCCAGCCATTGGATTATGAA[C/T]AAAACAAGCTCTACAAGTTGCACGTCTTGGCCTCGGATGGCAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1153 2532 18 35
Genomic Location:
Chromosome 7 (position 49023562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCAGATATGTTTAACATCAATCCGGCAACTGGGACTGTTTCTGTAT[C/A]GATGTCTGGCCTGGACAGGGAACAGATTGACTCGTATGTATTGGTGGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h0238q27