LOC556807

Ensembl ID:
ENSDARG00000078088
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15748 Nonsense Available for shipment Available now
sa40994 Nonsense Mutation detected in F1 DNA During 2016
sa40993 Nonsense Mutation detected in F1 DNA During 2016
sa34166 Nonsense Mutation detected in F1 DNA During 2016
sa40992 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34165 Nonsense Mutation detected in F1 DNA During 2016
sa15416 Nonsense Available for shipment Available now
sa40991 Nonsense Mutation detected in F1 DNA During 2016
sa21053 Nonsense Available for shipment Available now
sa27032 Nonsense Mutation detected in F1 DNA During 2016
sa27030 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 95 2532 2 35
Genomic Location (Zv9):
Chromosome 7 (position 49150793)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47418412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAACGGRCACGTGCGGACRACAGGCCTCCCCCTTCAGAGAGACAGA[G/T]AGTATCTYCTAACAGTARTGGCTGCAGACCGGCAGGGCAGCCGCAGWCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 154 2532 3 35
Genomic Location (Zv9):
Chromosome 7 (position 49145037)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47412656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTTTCTTTTCTCACCCAGCTTTCTTGTCACTCCTGCGGTGTCCTTC[C/T]AAAAGCAGCCAGTGACGTACAGCCTGCTCATCAATCCCAGCAGTCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 187 2532 3 35
Genomic Location (Zv9):
Chromosome 7 (position 49144936)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47412555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCCAGCCTGAGACGGGGGAGATCAGTCTGACCCGCTCTATAGACTA[T/A]GAGAGTGATCAGCACCGCTACCTGCTGCTGGTGAGGGCCAGTGAGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 442 2532 9 35
Genomic Location (Zv9):
Chromosome 7 (position 49076645)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47344264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGTTCTTTGTTTTTGTCCCCTCCTCAATCCCTTAGTGTGCCGAGTA[T/A]AAGGAGAAGGCCTCAGTTCTGGAAAATAAGCCTGCAGGATCATTTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Essential Splice Site 791 2532 14 35
Genomic Location (Zv9):
Chromosome 7 (position 49050056)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47317675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTCTCCAAGTGTCAGCCAATGATCTTGACCTGGGGCTGAATGGAAAG[G/A]TATGTAATTTTGAGTTGAATTAGCTATTCACTGAATCTGCCTCCGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 877 2532 16 35
Genomic Location (Zv9):
Chromosome 7 (position 49034200)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47301819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCAGTGACGTGAACGATAACAAGCCGGTGTTTGCCCAGCCTGTATA[T/G]GAAGTGGACGTGGATGAGGATGCTGACGTGGGCTCCACCGTCCTCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 939 2532 17 35
Genomic Location (Zv9):
Chromosome 7 (position 49026457)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47294076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCCTGAGGTGGGGACCAYCTTCAWCGCCCAGCCATTGGATTATGAA[C/T]AAAACAAGCTCTACAAGTTGCACGTCTTGGCCTCGGATGGCAAGTGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1094 2532 18 35
Genomic Location (Zv9):
Chromosome 7 (position 49023740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47291359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCCTATTTTTGCGTGTGCTCCGGACAGTTGCCATGGAGATGTGGCT[G/T]AAAATTCTCCCCCTGGCACCTCTGTCATGGAGATGACGGCCACTGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1153 2532 18 35
Genomic Location (Zv9):
Chromosome 7 (position 49023562)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47291181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCAGATATGTTTAACATCAATCCGGCAACTGGGACTGTTTCTGTAT[C/A]GATGTCTGGCCTGGACAGGGAACAGATTGACTCGTATGTATTGGTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Nonsense 1536 2532 20 35
Genomic Location (Zv9):
Chromosome 7 (position 49017373)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47284992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACACCTGATGCGCAATCTATGTTTTGACACATGGTTTTTTTTTATAA[T/A]GACAGGGAGAATGCCAACCAATGTGCTGGGAAAGGTTTACTCTCCAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109511 Essential Splice Site 2414 2532 35 35
Genomic Location (Zv9):
Chromosome 7 (position 48879327)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 47146946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCTCCCGAGCGGGAACAGCCACCACCACCACCTCCTCCATCTCCTC[A/C]GGATCTGCCACCATCCGCAGGGATGTCCCCCCCTGCCGCTCTCCGGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link