ARMC5

Ensembl ID:
ENSDARG00000078083
Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Human Orthologue:
ARMC5
Human Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Mouse Orthologue:
Armc5
Mouse Description:
armadillo repeat containing 5 Gene [Source:MGI Symbol;Acc:MGI:2384586]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12239 Nonsense Available for shipment Available now
sa15905 Nonsense Available for shipment Available now
sa824 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa12239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 330 673 7 11
Genomic Location:
Chromosome 3 (position 31201730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTSCCTCCAGGTCTTG[G/A]CTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGTKAGCTGACTGAATGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 342 673 7 11
Genomic Location:
Chromosome 3 (position 31201696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTSCCTCCAGGTCTTGRCTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGT[G/T]AGCTGACTGAATGCCCGAGCGGRCCTGATGTGTTTGGTGGCAGCCCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa824
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Essential Splice Site 484 673 8 11
Genomic Location:
Chromosome 3 (position 31200915)
KASP Assay ID:
554-0728.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACAGACAGACAGTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAG[G/A]TTTGTGACTTTAGTATTCATTGGGATATAAATAATAGGGTATATGCCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wuttzxvo