ARMC5

Ensembl ID:
ENSDARG00000078083
Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Human Orthologue:
ARMC5
Human Description:
armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
Mouse Orthologue:
Armc5
Mouse Description:
armadillo repeat containing 5 Gene [Source:MGI Symbol;Acc:MGI:2384586]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33201 Nonsense Mutation detected in F1 DNA During 2016
sa33200 Nonsense Mutation detected in F1 DNA During 2016
sa12239 Nonsense Available for shipment Available now
sa15905 Nonsense Available for shipment Available now
sa824 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa33201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 19 673 1 11
Genomic Location:
Chromosome 3 (position 31208360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCAGGAAGTTTGTGGACCTGGCACTGAGCATCTTGGCCAACTGCTG[C/A]ACTGAAAAGGGGACCAGACTACAAGTGAGGAAATATTCATTATAGTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 160 673 4 11
Genomic Location:
Chromosome 3 (position 31204076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGCTGCAGTGCGGAGTGTGCCAGAGAGATGTCCCGCTCTGGGGCTT[T/A]GACTCAGCTCGGGGTTCTGGCTTCGGGAGAAGACGGTCGGCCTTTGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 330 673 7 11
Genomic Location:
Chromosome 3 (position 31201730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTSCCTCCAGGTCTTG[G/A]CTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGTKAGCTGACTGAATGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Nonsense 342 673 7 11
Genomic Location:
Chromosome 3 (position 31201696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTSCCTCCAGGTCTTGRCTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGT[G/T]AGCTGACTGAATGCCCGAGCGGRCCTGATGTGTTTGGTGGCAGCCCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa824
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112266 Essential Splice Site 484 673 8 11
Genomic Location:
Chromosome 3 (position 31200915)
KASP Assay ID:
554-0728.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACAGACAGACAGTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAG[G/A]TTTGTGACTTTAGTATTCATTGGGATATAAATAATAGGGTATATGCCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link