ENSDARG00000078081

Ensembl ID:
ENSDARG00000078081
Human Orthologue:
ARHGEF15
Human Description:
Rho guanine nucleotide exchange factor (GEF) 15 [Source:HGNC Symbol;Acc:15590]
Mouse Orthologue:
Arhgef15
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 15 Gene [Source:MGI Symbol;Acc:MGI:3045246]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20701 Nonsense Mutation detected in F1 DNA During 2014
sa20702 Nonsense Mutation detected in F1 DNA During 2014
sa5751 Nonsense F2 line generated During 2014
sa2306 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa20701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109490 Nonsense 81 398 2 11
Genomic Location:
Chromosome 6 (position 26641529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGCACCACGAGACAGGAAGTCATTGTTTTCTAGCATTGCAAAAATT[A/T]AAGAGATCAGTCAAAGGTAAGAACCAGCCAGGTTATTTGTTTATCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109490 Nonsense 119 398 3 11
Genomic Location:
Chromosome 6 (position 26643539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTCTGTGATGTTGTACACCAGTATGCACTTGGACCCTTTGATGCTTA[T/G]ATAACTTACATCCGTAATATGCCCTATCAAGAACAGACATTACACAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5751
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109490 Nonsense 358 398 11 11
ENSDART00000109490 Nonsense 358 398 11 11
Genomic Location:
Chromosome 6 (position 26653544)
KASP Assay ID:
554-2902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCTCTGCTGTTGTAGGGTTCCTGGAGGGCCGTAGAGTACAGGATGGA[C/T]AGYGGGGCTGGTTCWCGGCCTCATGYGTRGTAGAGATCACTAATGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2306
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109490 Nonsense 358 398 11 11
ENSDART00000109490 Nonsense 358 398 11 11
Genomic Location:
Chromosome 6 (position 26653544)
KASP Assay ID:
554-2902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCTCTGCTGTTGTAGGGTTCCTGGAGGGCCGTAGAGTACAGGATGGA[C/T]AGYGGGGCTGGTTCWCGGCCTCATGYGTRGTAGAGATCACTAATGAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cjh59sph