pknox1.1

Ensembl ID:
ENSDARG00000078080
ZFIN ID:
ZDB-GENE-020122-5
Description:
pbx/knotted 1 homeobox 1.1 [Source:RefSeq peptide;Acc:NP_571966]
Human Orthologue:
PKNOX1
Human Description:
PBX/knotted 1 homeobox 1 [Source:HGNC Symbol;Acc:9022]
Mouse Orthologue:
Pknox1
Mouse Description:
Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25422 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053210 Missense 369 433 10 11
ENSDART00000111771 Nonsense 369 377 11 12

The following transcripts of ENSDARG00000078080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 20584076)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19737953
KASP Assay ID:
554-7590.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCCGACTCCATCGCCTCAACAGGAAGCCAGCAGCAGCTCACAATGC[C/T]AGACGGTACAATTTAAGTTCTTCTAACTTGACCCATGACCCAGTTGTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link