nudt5

Ensembl ID:
ENSDARG00000078073
ZFIN ID:
ZDB-GENE-040625-63
Description:
ADP-sugar pyrophosphatase [Source:RefSeq peptide;Acc:NP_001002086]
Human Orthologue:
NUDT5
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 5 [Source:HGNC Symbol;Acc:8052]
Mouse Orthologue:
Nudt5
Mouse Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 5 Gene [Source:MGI Symbol;Acc:MGI:1858232]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9438 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109252 Nonsense 158 217 7 10
ENSDART00000111901 Nonsense 158 217 7 9
Genomic Location (Zv9):
Chromosome 4 (position 7052599)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7863818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTATGGTGCATATTAATGGAGACGACATTGAAAATATAAACCCCACA[C/T]AGCAGCTGGGTGAGTAAAGGAGCATTACTGTATCTAACACAGTCATGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link