si:ch211-232i5.1

Ensembl ID:
ENSDARG00000078072
ZFIN ID:
ZDB-GENE-070705-127
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5G2]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13560 Nonsense Available for shipment Available now
sa36973 Nonsense Mutation detected in F1 DNA During 2017
sa8827 Nonsense Available for shipment Available now
sa9461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 70 978 2 8
ENSDART00000133637   None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8287084)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8121353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTCTCGCACCACGTGTAGTCTTTAAAGATGACAAAAATCTCAGTCGC[C/T]AGCTCTCCCCAMCWTGGGGATCAAAACCCAGTGACAACCAGTTCGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 444 978 2 8
ENSDART00000133637   None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285962)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8120231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTCAAAGATTTCTGAGCCAGCCATTACAACACCAGTCATTCCTGAT[C/T]AAACTGTCCCTAAGACTTCTAAACCAGATCCATCTTTTACAACTCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637   None 135 None 5
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637   None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285183)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8119452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCTCCATCAGAAGTCCCTGTTATCCCTAAACTCCCWCCAGTTGACTA[T/A]GTAGATCATKCAAGRTTTCCACCTAAAGCCCAAATACCTGAACTGGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637   None 135 None 5
ENSDART00000113993 Nonsense 703 978 2 8
ENSDART00000133637   None 135 None 5
Genomic Location (Zv9):
Chromosome 20 (position 8285183)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8119452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCTCCATCAGAAGTCCCTGTTATCCCTAAACTCCCWCCAGTTGACTA[T/A]GTAGATCATKCAAGRTTTCCACCTAAAGCCCAAATACCTGAACTGGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link