si:dkey-126h10.1

Ensembl ID:
ENSDARG00000078070
ZFIN ID:
ZDB-GENE-070424-201
Description:
Novel protein similar to vertebrate solute carrier family 32 (GABA vesicular transporter), member 1
Human Orthologue:
SLC32A1
Human Description:
solute carrier family 32 (GABA vesicular transporter), member 1 [Source:HGNC Symbol;Acc:11018]
Mouse Orthologue:
Slc32a1
Mouse Description:
solute carrier family 32 (GABA vesicular transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1194

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8973 Nonsense Mutation detected in F1 DNA During 2017
sa12972 Essential Splice Site Available for shipment Available now
sa23622 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109269 Nonsense 60 400 2 4
ENSDART00000136645 Nonsense 60 397 2 3
Genomic Location (Zv9):
Chromosome 20 (position 1748328)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1704193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGCTACACTGGTAAGATCCTGGTGTCCTGCTTGTAYGAAGAGGAT[G/T]AGAGCGGCTGCCCGGTCCGCGTAAGACACACCTACGAGGACATCGCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109269 Essential Splice Site 254 400 2 4
ENSDART00000136645 Essential Splice Site 254 397 2 3
Genomic Location (Zv9):
Chromosome 20 (position 1747742)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1703607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTCTCTGTGCTGGYCTTCCTAACKTGGGGAGAGGAAACTAAAGAGG[T/C]GCGCTGATCTCACATGMCTGTAGACATCGCTAAMGTCCTGATATACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109269 Nonsense 388 400 3 4
ENSDART00000136645 Nonsense 388 397 3 3
Genomic Location (Zv9):
Chromosome 20 (position 1746807)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1702672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTGCTGGGCGGATTCTGCAGCGTCTCCGGGGTCATCTGCTCCATC[A/T]GAGGGATGATAACCGCCTTTGAGGACAAGTAGATAACACGTCGTCCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link