abcg4b

Ensembl ID:
ENSDARG00000078068
ZFIN ID:
ZDB-GENE-080215-10
Description:
ATP-binding cassette, sub-family G (WHITE), member 4b [Source:RefSeq peptide;Acc:NP_001104682]
Human Orthologue:
ABCG4
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 4 [Source:HGNC Symbol;Acc:13884]
Mouse Orthologue:
Abcg4
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 4 Gene [Source:MGI Symbol;Acc:MGI:1890594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7405 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Missense 138 644 4 15
Genomic Location:
Chromosome 15 (position 22853684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGACAGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGRACCTTTC[G/T]TAAAATGTCCTGTTACATTATGCAAGAAGACAAATTGCTGCCTCAYTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kniet2qb