abcg4b

Ensembl ID:
ENSDARG00000078068
ZFIN ID:
ZDB-GENE-080215-10
Description:
ATP-binding cassette, sub-family G (WHITE), member 4b [Source:RefSeq peptide;Acc:NP_001104682]
Human Orthologue:
ABCG4
Human Description:
ATP-binding cassette, sub-family G (WHITE), member 4 [Source:HGNC Symbol;Acc:13884]
Mouse Orthologue:
Abcg4
Mouse Description:
ATP-binding cassette, sub-family G (WHITE), member 4 Gene [Source:MGI Symbol;Acc:MGI:1890594]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42544 Nonsense Mutation detected in F1 DNA During 2016
sa7405 Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Nonsense 124 644 4 15
Genomic Location (Zv9):
Chromosome 15 (position 22853727)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23564914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTAAAAATCTTGTTATGTGCTTTATAGGGAAACAGGGATGACTGGA[C/T]AGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGAACCTTTCGTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115051 Missense 138 644 4 15
Genomic Location (Zv9):
Chromosome 15 (position 22853684)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23564871
KASP Assay ID:
554-4030.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGACAGATCCTAGTAAATGGAAAGCTCCGAGACCCCCGRACCTTTC[G/T]TAAAATGTCCTGTTACATTATGCAAGAAGACAAATTGCTGCCTCAYTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link