LOC100329566

Ensembl ID:
ENSDARG00000078056
Human Orthologues:
AL390719.1, RNF208
Human Description:
ring finger protein 208 [Source:HGNC Symbol;Acc:25420]
Mouse Orthologue:
Rnf208
Mouse Description:
ring finger protein 208 Gene [Source:MGI Symbol;Acc:MGI:1916096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7335 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108959 Missense 94 241 2 2
Genomic Location:
Chromosome 10 (position 17047703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCACGGCTGACATCTGCTACCACCAGTTCCACTACAAGATGGATGATG[T/A]AATCGTCAACCAGTACGTGCTCCGCTCTTCTTCCACCTCGTCCTCCTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g4hvmrew