emilin3a

Ensembl ID:
ENSDARG00000078052
ZFIN ID:
ZDB-GENE-080612-2
Description:
Novel protein similar to vertebrate elastin microfibril interfacer family [Source:UniProtKB/TrEMBL;A
Human Orthologue:
EMILIN3
Human Description:
elastin microfibril interfacer 3 [Source:HGNC Symbol;Acc:16123]
Mouse Orthologue:
Emilin3
Mouse Description:
elastin microfibril interfacer 3 Gene [Source:MGI Symbol;Acc:MGI:2389142]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15954 Essential Splice Site Available for shipment Available now
sa7134 Nonsense Mutation detected in F1 DNA During 2014
sa10922 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112381 Essential Splice Site 110 687 3 6
ENSDART00000113858 None None 711 None 7
ENSDART00000143791 None None 69 None 2
ENSDART00000148178 None None 308 None 2
Genomic Location:
Chromosome 8 (position 23818304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAAGGGCCCATGCCAATGCAGAAAGGTCCTATGYCTTCATTTAAAG[G/T]TCCAATGCCTATACAGAAAGGTCCTATGCCYTCCTTTAAAGGTCCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112381 Nonsense 234 687 5 6
ENSDART00000113858 Nonsense 274 711 5 7
ENSDART00000143791 None None 69 None 2
ENSDART00000148178 Nonsense 292 308 2 2
Genomic Location:
Chromosome 8 (position 23817147)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAAACACCACCCTTCAAAGACTATCWGGTGGGTCAGTGAACCTTAAT[C/T]AAACTGAAATCCAAAAGGCCCTGGAAACAATGGTGGAGTCCAAAATGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112381 Nonsense 329 687 5 6
ENSDART00000113858 Nonsense 369 711 5 7
ENSDART00000143791 None None 69 None 2
ENSDART00000148178 None None 308 None 2
Genomic Location:
Chromosome 8 (position 23816861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCAGCTTCAAGACCTGGAGCCTGAAGAGGGTTGCTGCATTGCCATAT[C/A]AGGTCTAACTGAAAGGGTCATTYATRTGGAGCAGTCAGTGGAAGGTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b29m2qkw