mia2

Ensembl ID:
ENSDARG00000078023
ZFIN ID:
ZDB-GENE-100618-1
Description:
LOC100150328 protein [Source:UniProtKB/TrEMBL;Acc:A5PLB3]
Human Orthologue:
MIA2
Human Description:
melanoma inhibitory activity 2 [Source:HGNC Symbol;Acc:18432]
Mouse Orthologue:
Mia2
Mouse Description:
melanoma inhibitory activity 2 Gene [Source:MGI Symbol;Acc:MGI:2159614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19167 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114338 Essential Splice Site 37 367 2 4
Genomic Location:
Chromosome 17 (position 12946467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGACATGCTTTCTTATCTTTGACTTTTTGTCCAATTTTTTCTTTTTTC[A/T]GGAATGATAAGTCGTGTGCAGGCACAGAGAGATCATGTTACTAAAGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rv6poc5x