FYCO1 (2 of 2)

Ensembl ID:
ENSDARG00000078022
Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Human Orthologue:
FYCO1
Human Description:
FYVE and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:14673]
Mouse Orthologue:
Fyco1
Mouse Description:
FYVE and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:107277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11360 Nonsense Available for shipment Available now
sa14590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111145 Nonsense 46 1372 2 18
ENSDART00000114182 Nonsense 46 1347 2 17
Genomic Location:
Chromosome 2 (position 51333231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACACCGAAGAKCCCATCACCGATGACAGCTCCAGCCTTCACAAGTTCTG[T/A]TTTAAACTGGAGTACCTGCTGCAAGTATGGCTCAGNTTTTTTGTCTTRCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111145 Nonsense 765 1372 7 18
ENSDART00000114182 Nonsense 765 1347 7 17
Genomic Location:
Chromosome 2 (position 51347209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGCGTGCCGAAATYCAAACTAGCATGACTTCAATGAAGGAAGAGTG[T/A]CATGCTTTGAAGAAGCACAACAGCACACTTGCACTTGAGAATGGAGAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jnnvxyee