LOC100334900

Ensembl ID:
ENSDARG00000078018
Human Orthologue:
ZNF70
Human Description:
zinc finger protein 70 [Source:HGNC Symbol;Acc:13140]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11683 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114505 Nonsense 546 793 2 2
Genomic Location:
Chromosome 16 (position 26979937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCKAACATTCCKGKTTCTACACCTTCAGTAGTGCGTCCCTTGTTGT[T/A]GAATCCACCGAGGTTGACTATTCGTGTCCCTACGCCTTCCAGTCGTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m1vggu8a