pacsin2

Ensembl ID:
ENSDARG00000078014
ZFIN ID:
ZDB-GENE-040426-2596
Description:
protein kinase C and casein kinase substrate in neurons 2 [Source:RefSeq peptide;Acc:NP_996952]
Human Orthologue:
PACSIN2
Human Description:
protein kinase C and casein kinase substrate in neurons 2 [Source:HGNC Symbol;Acc:8571]
Mouse Orthologue:
Pacsin2
Mouse Description:
protein kinase C and casein kinase substrate in neurons 2 Gene [Source:MGI Symbol;Acc:MGI:1345153]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16198 Nonsense Available for shipment Available now
sa13662 Nonsense Available for shipment Available now
sa20325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092415 Nonsense 66 490 3 12
Genomic Location (Zv9):
Chromosome 4 (position 62027635)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76558762
KASP Assay ID:
2259-5286.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGAGAAGAGCTACAGCACACAGCTCACCGACTGGGCCAAGCGCTGGAGA[C/T]AGACCATCGAGAAAGGTGGANNNNNNRCGCACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13662
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092415 Nonsense 114 490 4 12
Genomic Location (Zv9):
Chromosome 4 (position 62028752)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76559879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGAAGGCCGCTCTGATGGCGGAGGACTTYGAGAAGATCAAGAACTGG[C/T]AGAAGGACGCCTACCACAAGCARATGATCGGGGGCTTCAAGGAGACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092415 Nonsense 229 490 6 12
Genomic Location (Zv9):
Chromosome 4 (position 62032772)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76563899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAAGGTGACGCCGCAGTACATGGAGAACATGGAGCAGGTGTTCGAG[C/T]AGTGGCAGCAGTTCGAGGGAAAGAGATTGAGCTTCTTCAAGGAGGTCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link