NAV1 (1 of 3)

Ensembl ID:
ENSDARG00000078011
Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Human Orthologue:
NAV1
Human Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Mouse Orthologue:
Nav1
Mouse Description:
neuron navigator 1 Gene [Source:MGI Symbol;Acc:MGI:2183683]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10965 Nonsense Available for shipment Available now
sa16509 Nonsense Available for shipment Available now
sa29871 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115403 Nonsense 149 2168 1 30
Genomic Location (Zv9):
Chromosome 23 (position 5889501)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5905662
KASP Assay ID:
2261-7307.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACGGCAACAAGAATTTCCAGAGTGGGATCTTTCGTTCTCAGCCAGGA[C/T]AAATAGACAATGGTAATCTCAGGAGTGTGATCTCAGAACAACTCAAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115403 Nonsense 497 2168 3 30
Genomic Location (Zv9):
Chromosome 23 (position 5922816)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5938977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAAGGCTCAAGAGCCGGCTGATGACAGCAAGTCCGATGATGAGATCT[T/A]GTCCAGCAAGGCTAAAKCTAATGGTAAGAAATCTTTGAGTGGTACTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115403 Essential Splice Site 596 2168 4 30
Genomic Location (Zv9):
Chromosome 23 (position 5957230)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5973246
KASP Assay ID:
2261-7309.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTGGAAGAGACCATGTCCAGCTTACGGGGGTCCCAGCTTAGCCACAG[G/A]TATGGAAGTCACACTTTTAGTGCTTGAAAAGGCCACAGAGTCTGTGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link