LOC100333016

Ensembl ID:
ENSDARG00000078008
Human Orthologue:
ATG7
Human Description:
ATG7 autophagy related 7 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16935]
Mouse Orthologue:
Atg7
Mouse Description:
autophagy-related 7 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1921494]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41752 Nonsense Mutation detected in F1 DNA During 2016
sa10973 Essential Splice Site Available for shipment Available now
sa35001 Nonsense Mutation detected in F1 DNA During 2016
sa14768 Nonsense Available for shipment Available now
sa14235 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111987 Nonsense 35 697 1 23
Genomic Location (Zv9):
Chromosome 11 (position 882227)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 863223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGGATTCTGGCATCAGCTCACACAGAAGAAACTCAACGAGTACCGCT[T/G]AGACGAAAGTCCAAAAAACATCAAGGGATATTACTATAACGGTGAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111987 Essential Splice Site 132 697 4 23
Genomic Location (Zv9):
Chromosome 11 (position 875450)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 858451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGAAGACTCTTCAATCCTCAACAAGTTCATCCTCTTGACATTTGCGG[T/C]TTGTGTGCCAACATTTTAGAAAATGTCCCWGTAAAATTAATGTCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111987 Nonsense 173 697 6 23
Genomic Location (Zv9):
Chromosome 11 (position 873542)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 856260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTCGATGAGGTGCGCTGATTGTTTTGGATCGATTTGTTTCACAGATAT[C/A]GAGTTTGCAATCGGCGTATGATAATCTCTGTGCCTCCAGCGGAACGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111987 Nonsense 448 697 15 23
Genomic Location (Zv9):
Chromosome 11 (position 854601)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 837262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCCKATGCCCGGACACCCTGTCAACTTCYCAGATCTGACCGTAGCT[C/T]AAGCGCAGCAGGACGTGGAGCAGCTGAAAAAACTCATTTCWGAACRYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111987 Essential Splice Site 554 697 18 23
Genomic Location (Zv9):
Chromosome 11 (position 846616)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 829277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACCGTCTCGGCTGTTACTTCTGCAATGAWGTGGTGGCTCCTGGAGAC[G/A]TGAGTTTAATCAAGCACTTTTACATCTGTGGTCAAATCAGATTTTCCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link