ENSDARG00000078007

Ensembl ID:
ENSDARG00000078007
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5803 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5803
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109706 Nonsense 171 686 2 5
Genomic Location:
Chromosome 22 (position 19788264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACATGAAACTGGTGCAAAAGGCAGAGGTGCTCTAGTTACTCTGYTGT[C/A]AAAAGAAACATTTAATAAAGTTGTGGATGTCATTGGCCAGCTRATAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c57v9ntq