si:ch211-55a7.1

Ensembl ID:
ENSDARG00000078006
ZFIN ID:
ZDB-GENE-091118-93
Human Orthologue:
WSCD1
Human Description:
WSC domain containing 1 [Source:HGNC Symbol;Acc:29060]
Mouse Orthologue:
Wscd1
Mouse Description:
WSC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2448493]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa737 Nonsense Available for shipment Available now
sa34962 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113112 Nonsense 128 572 2 8
ENSDART00000135480   None 552 None 8
ENSDART00000141731   None 234 None 4
Genomic Location (Zv9):
Chromosome 10 (position 39358495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38050801
KASP Assay ID:
554-0644.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACCAAAAATAGAATAACCATTTTRCATTYAAATTATTTTTGAGTTCT[A/T]AATGCTGTTCTCATTCTCAATCAGGGACCTACATTGGATGTTTCATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113112 Nonsense 306 572 5 8
ENSDART00000135480 Nonsense 286 552 5 8
ENSDART00000141731 Nonsense 23 234 1 4
Genomic Location (Zv9):
Chromosome 10 (position 39364061)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38056367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGCCGTGCCTCATTTCTTTTGACAATCCAGATGAGTGAAAATGAC[C/T]AAATGTGCAAGAAGGCCAACCAAACAAACCAGACTTCCCTTCATGACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link