si:ch211-221b16.9

Ensembl ID:
ENSDARG00000078001
ZFIN ID:
ZDB-GENE-070912-204
Description:
Novel protein similar to vertebrate kelch repeat and BTB (POZ) domain [Source:UniProtKB/TrEMBL;Acc:A
Human Orthologues:
KBTBD6, KBTBD7
Human Descriptions:
kelch repeat and BTB (POZ) domain containing 6 [Source:HGNC Symbol;Acc:25340]
kelch repeat and BTB (POZ) domain containing 7 [Source:HGNC Symbol;Acc:25266]
Mouse Orthologues:
Gm5465, Kbtbd7
Mouse Descriptions:
kelch repeat and BTB (POZ) domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2685141]
predicted gene 5465 Gene [Source:MGI Symbol;Acc:MGI:3643058]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34600 Nonsense Available for shipment Available now
sa15388 Nonsense Available for shipment Available now
sa21458 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 51 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17940384)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17416454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAGTGGACGTGACCATAGAAGTGGAGCCTGACACCGAAACAGCAGAG[C/T]GAAGTGTTTCCTCTGGTGCTGGAAAAGTGTTTCAGTGTAGCAGGAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 74 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17940455)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17416525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAGTGTTYCAGTGTAGCAGGAATATACTGGCAGCRGCGAGCCCTTA[T/G]TTTAAGAGCATGTTTACAGGAGGACTGTACGAGAGCACGCAGAGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112884 Nonsense 455 617 1 1
Genomic Location (Zv9):
Chromosome 9 (position 17941598)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17417668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAATGAACGCCTTTATGTGGTAAACAAGAGGAGGATGCTGTGCTA[C/A]GAGCCAAAGAAAAACCACTGGCTCCAGCGGGCCTCTCTGAAGCGCAGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link