LOC100334005

Ensembl ID:
ENSDARG00000077999

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39431 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110935 Nonsense 197 206 2 2
Genomic Location (Zv9):
Chromosome 24 (position 440552)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 380524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTGGGCTGCGGATGGAGAACTCAGGATGGTACTGCTGCTCCACCCCT[G/T]AGCTGCAGATGCCGGTGTACATCAGTGTGGAGCAGAGGATGGAGAACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link