si:dkey-16l23.1

Ensembl ID:
ENSDARG00000077996
ZFIN ID:
ZDB-GENE-081104-50
Description:
Novel protein similar to vertebrate cadherin-like family [Source:UniProtKB/TrEMBL;Acc:B8A4Q1]
Human Orthologue:
CDH24
Human Description:
cadherin 24, type 2 [Source:HGNC Symbol;Acc:14265]
Mouse Orthologue:
Cdh24
Mouse Description:
cadherin-like 24 Gene [Source:MGI Symbol;Acc:MGI:1928330]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32985 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111261 Splice Site, Nonsense 743 1586 5 13
ENSDART00000138769   None 279 None 4
Genomic Location (Zv9):
Chromosome 2 (position 38356080)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38670994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTTTAACATCTCTGGAGCCAACCAGGAGGCCGTGATTATTCTGAAC[A/T]AGGTAGGAGAAAAGTCCAGGGAACTTACAGTGTGAGAAAGATAGAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link