si:ch211-261p7.4

Ensembl ID:
ENSDARG00000077994
ZFIN ID:
ZDB-GENE-070912-258
Description:
beta-1,4-galactosyltransferase 2 [Source:RefSeq peptide;Acc:NP_001121857]
Human Orthologue:
B4GALT2
Human Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 [Source:HGNC Symbol;Acc:925]
Mouse Orthologue:
B4galt2
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:18

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25848 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114663 Nonsense 172 379 2 6
ENSDART00000141192 Nonsense 172 379 3 7
Genomic Location (Zv9):
Chromosome 2 (position 33308186)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33607093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATCCCTTTCAGGCACAGAGACAACCATCTGAAATACTGGCTTCACTA[T/A]TTGCATCCAGTCCTGCGCAGACAGAAGATCGACTATGGGATCTATATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link