ABCC10

Ensembl ID:
ENSDARG00000077988
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 [Source:HGNC Symbol;Acc:52]
Human Orthologue:
ABCC10
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 [Source:HGNC Symbol;Acc:52]
Mouse Orthologue:
Abcc10
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 Gene [Source:MGI Symbol;Acc:MGI:2386976]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2584 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2584
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115249 Nonsense 379 1548 2 21
Genomic Location:
Chromosome 11 (position 12090520)
KASP Assay ID:
554-2442.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGTGGGTTTCATGGAGACTGAAGGAGCACCACTGAGCAAGGGTGTGT[G/A]GTGCRCTGTAGGGCTTTTTGCTAGTACTTTTCTTGCTGCCCTGCTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tbp1fs11