ABCC10

Ensembl ID:
ENSDARG00000077988
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 [Source:HGNC Symbol;Acc:52]
Human Orthologue:
ABCC10
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 [Source:HGNC Symbol;Acc:52]
Mouse Orthologue:
Abcc10
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 10 Gene [Source:MGI Symbol;Acc:MGI:2386976]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2584 Nonsense F2 line generated During 2016
sa30944 Nonsense Mutation detected in F1 DNA During 2016
sa38830 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2584
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115249 Nonsense 379 1548 2 21
Genomic Location:
Chromosome 11 (position 12090520)
KASP Assay ID:
554-2442.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGTGGGTTTCATGGAGACTGAAGGAGCACCACTGAGCAAGGGTGTGT[G/A]GTGCRCTGTAGGGCTTTTTGCTAGTACTTTTCTTGCTGCCCTGCTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115249 Nonsense 400 1548 2 21
Genomic Location:
Chromosome 11 (position 12090456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTGCTAGTACTTTTCTTGCTGCCCTGCTAAAAAACATCTTTGTTTA[T/G]GAAGTATCAAAGGTTGCCCTGGAAGCTCGGGCTGCTGTGATTTCCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115249 Nonsense 1143 1548 14 21
Genomic Location:
Chromosome 11 (position 12064381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCCTTGGGTTCTGCTGCCTTTGGTTCCTTTGGGGGCGCTTTACTAC[C/T]AAACTCAGTGTTTTTATCGTTACTCGTCCCGTGAGCTGAAACGCCTGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link