TMEM151A (1 of 2)

Ensembl ID:
ENSDARG00000077986
Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Human Orthologue:
TMEM151A
Human Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Mouse Orthologue:
Tmem151a
Mouse Description:
transmembrane protein 151A Gene [Source:MGI Symbol;Acc:MGI:2147713]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40862 Nonsense Mutation detected in F1 DNA During 2016
sa40863 Nonsense Mutation detected in F1 DNA During 2016
sa5763 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa40862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111144 Nonsense 431 607 2 2
Genomic Location (Zv9):
Chromosome 7 (position 21049999)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19640435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCAACTCTACCAGTGGCCTTTACCTCTGCCTACTTGCTCCAAAACTG[T/A]CCTCGGTGCCGCCGCACCACAAGCAGCGCTTCCCTTCCATCCCGACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111144 Nonsense 565 607 2 2
Genomic Location (Zv9):
Chromosome 7 (position 21050399)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19640835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGTGGAAAGAGAAGAAGAAGGGGAGAGAGAAGGGGAGCAAAGAGAG[C/T]AACAGGAGGATGCAGAAGAAGAGGAAGCAAGGGAAGGAGACAGACCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5763
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111144 Nonsense 583 607 2 2
ENSDART00000111144 Nonsense 583 607 2 2
Genomic Location (Zv9):
Chromosome 7 (position 21050455)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19640891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATGCAGAAGAAGAGGAAGCAAGGGAAGGAGACAGACCTCCTACATA[T/A]CAGGATGCCTTTTTCTTCCCRGTGTTGATTGTGCATGGAGAGGAGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link