TMEM151A (1 of 2)

Ensembl ID:
ENSDARG00000077986
Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Human Orthologue:
TMEM151A
Human Description:
transmembrane protein 151A [Source:HGNC Symbol;Acc:28497]
Mouse Orthologue:
Tmem151a
Mouse Description:
transmembrane protein 151A Gene [Source:MGI Symbol;Acc:MGI:2147713]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2399 Nonsense Mutation detected in F1 DNA During 2014
sa5763 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111144 Nonsense 583 607 2 2
ENSDART00000111144 Nonsense 583 607 2 2
Genomic Location:
Chromosome 7 (position 21050455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATGCAGAAGAAGAGGAAGCAAGGGAAGGAGACAGACCTCCTACATA[T/A]CAGGATGCCTTTTTCTTCCCRGTGTTGATTGTGCATGGAGAGGAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5763
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111144 Nonsense 583 607 2 2
ENSDART00000111144 Nonsense 583 607 2 2
Genomic Location:
Chromosome 7 (position 21050455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGATGCAGAAGAAGAGGAAGCAAGGGAAGGAGACAGACCTCCTACATA[T/A]CAGGATGCCTTTTTCTTCCCRGTGTTGATTGTGCATGGAGAGGAGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ycv2ldu0