gpr89b

Ensembl ID:
ENSDARG00000077983
Human Orthologues:
GPR89A, GPR89B, GPR89C
Human Descriptions:
G protein-coupled receptor 89A [Source:HGNC Symbol;Acc:31984]
G protein-coupled receptor 89B [Source:HGNC Symbol;Acc:13840]
G protein-coupled receptor 89C [Source:HGNC Symbol;Acc:31985]
Mouse Orthologue:
Gpr89
Mouse Description:
G protein-coupled receptor 89 Gene [Source:MGI Symbol;Acc:MGI:1914799]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34549 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27337 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115404 Essential Splice Site 105 455 4 14
Genomic Location (Zv9):
Chromosome 9 (position 5954847)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5936143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGCCTTTCTACATTGGCTACTTTGTGGTCAGTAATATACGTTTATG[T/C]AAGTATATTTGTCTTTTTATATTCTGTAAGCTTTTCTACTAGTTTGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115404 Nonsense 329 455 11 14
Genomic Location (Zv9):
Chromosome 9 (position 5945524)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 5926820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGGAAGACTGACCCGGTGACGAGGGGAATCGAGATCACCGTCAACTA[T/A]CTTGGAATTCAGTTTGATGTATGTATATGTATATTTGGCTGAATATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link